Field | Sense | Antisense |
siRNA chemical modification | 0 | 2-O-Guanidinopropyl |
siRNA modification types | 0 | 1 |
Overall number of modifications | 0 | 1 |
Position of modifications | 0 | 4 |
Modification on sugar or base or phosphate | 0 | Sugar |
SMILES (Click to view structure & nomenclature) |
- |
NC(=N)NCCCOC1COC(CO)C1O |
siRNA Sequence | ACCUUGAGGCAUACUUCAATT | UUGAAGUAUGCCUCAAGGUCG |
siRNA length base-pair | 21 | 21 |
siRNA name in paper | GP4 siRNA3 | GP4 siRNA3 |
Biological activity | 92 percent target mRNA inhibition | |
Experiment used to check activity | Luciferase reporter assay | |
Melting temperature (oC) | NA | |
Target gene | HBx gene of hepatitis B virus | |
siRNA concentration | 10 nM | |
Cell or Organism used | Huh7 cells | |
Transfection method | Lipofectamine 2000 | |
Duration after transfection | 48 Hours | |
Article title | Inhibition of hepatitis B virus replication in cultured cells and in vivo using 2'-O-guanidinopropyl modified siRNAs |
|
Reference | 23743442 |