| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 2-O-Guanidinopropyl |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 1 |
| Position of modifications | 0 | 21 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
NC(=N)NCCCOC1COC(CO)C1O |
| siRNA Sequence | ACCUUGAGGCAUACUUCAATT | UUGAAGUAUGCCUCAAGGUCG |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | GP21 siRNA3 | GP21 siRNA3 |
| Biological activity | 93 percent target mRNA inhibition | |
| Experiment used to check activity | Luciferase reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | HBx gene of hepatitis B virus | |
| siRNA concentration | 10 nM | |
| Cell or Organism used | Huh7 cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 48 Hours | |
| Article title | Inhibition of hepatitis B virus replication in cultured cells and in vivo using 2'-O-guanidinopropyl modified siRNAs |
|
| Reference | 23743442 | |