| Field | Sense | Antisense |
| siRNA chemical modification | Naphthalene modification | 0 |
| siRNA modification types | 1 | 0 |
| Overall number of modifications | 1 | 0 |
| Position of modifications | 1 | 0 |
| Modification on sugar or base or phosphate | Sugar | 0 |
| SMILES (Click to view structure & nomenclature) |
C1=CC2=CC=CC=C2C=C1 |
- |
| siRNA Sequence | GGCCUUUCACUACUCCUACGA | GUAGGAGUAGUGAAAGGCCAG |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | Nap-siRNA | Nap-siRNA |
| Biological activity | 87 percent target mRNA inhibition | |
| Experiment used to check activity | Luciferase reporter assay | |
| Melting temperature (oC) | 83.13 | |
| Target gene | Luciferase gene | |
| siRNA concentration | 1 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 48 Hours | |
| Article title | SiRNAs conjugated with aromatic compounds induce RISC-mediated antisense strand selection and strong gene-silencing activity |
|
| Reference | 22982308 | |