| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 2-O-Methyl |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 20 |
| Position of modifications | 0 | 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
COC1C(O)OC(CO)C1O |
| siRNA Sequence | CUCCUUUUGUUUCUGCUAACG | CGUUAGCAGAAACAAAGGAG |
| siRNA length base-pair | 21 | 20 |
| siRNA name in paper | PTEN V5 | PTEN V5 |
| Biological activity | High target mRNA inhibition efficacy | |
| Experiment used to check activity | Real-time PCR | |
| Melting temperature (oC) | NA | |
| Target gene | Human PTEN gene | |
| siRNA concentration | 1 to 40 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Oligofectamine (Invitrogen) | |
| Duration after transfection | 48 Hours | |
| Article title | Structural variations and stabilising modifications of synthetic siRNAs in mammalian cells |
|
| Reference | 12771196 | |