| Field | Sense | Antisense |
| siRNA chemical modification | 2-Deoxy-2-Fluoro | 0 |
| siRNA modification types | 1 | 0 |
| Overall number of modifications | 9 | 0 |
| Position of modifications | 1,4,5,8,10,11,19,20,21 | 0 |
| Modification on sugar or base or phosphate | Sugar | 0 |
| SMILES (Click to view structure & nomenclature) |
OCC1OCC(F)C1O |
- |
| siRNA Sequence | UGGCCAAUGCCAAGGAGAUUU | AUCUCCUUGGCAUUGGCCAUU |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | A1S3 | A1S3 |
| Biological activity | 45 percent target mRNA inhibition | |
| Experiment used to check activity | Real-time PCR | |
| Melting temperature (oC) | 63.0 | |
| Target gene | Human TRACP 5a and 5b gene | |
| siRNA concentration | 0.1 nM | |
| Cell or Organism used | CHO cells | |
| Transfection method | Mirus Trans IT TKO (MirusBio, USA) | |
| Duration after transfection | 29 Hours | |
| Article title | RNA interference tolerates 2'-fluoro modifications at the Argonaute2 cleavage site |
|
| Reference | 17511001 | |