| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 2-Deoxy-2-Fluoro |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 14 |
| Position of modifications | 1,4,5,8,10,11,19,20,21 | 2,3,4,5,6,7,8,11,13,14,17,18,20,21 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
OCC1OCC(F)C1O |
| siRNA Sequence | UGGCCAAUGCCAAGGAGAUUU | AUCUCCUUGGCAUUGGCCAUU |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | A3S1 | A3S1 |
| Biological activity | 55 percent target mRNA inhibition | |
| Experiment used to check activity | Real-time PCR | |
| Melting temperature (oC) | 75.6 | |
| Target gene | Human TRACP 5a and 5b gene | |
| siRNA concentration | 0.1 nM | |
| Cell or Organism used | CHO cells | |
| Transfection method | Mirus Trans IT TKO (MirusBio, USA) | |
| Duration after transfection | 33 Hours | |
| Article title | RNA interference tolerates 2'-fluoro modifications at the Argonaute2 cleavage site |
|
| Reference | 17511001 | |