Field | Sense | Antisense |
siRNA chemical modification | 2-Deoxy-2-Fluoro | 0 |
siRNA modification types | 1 | 0 |
Overall number of modifications | 12 | 0 |
Position of modifications | 2,3,6,7,9,12,13,14,15,16,17,18 | 0 |
Modification on sugar or base or phosphate | Sugar | 0 |
SMILES (Click to view structure & nomenclature) |
OCC1OCC(F)C1O |
- |
siRNA Sequence | UGGCCAAUGCCAAGGAGAUUU | AUCUCCUUGGCAUUGGCCAUU |
siRNA length base-pair | 21 | 21 |
siRNA name in paper | A1S2 | A1S2 |
Biological activity | 51 percent target mRNA inhibition | |
Experiment used to check activity | Real-time PCR | |
Melting temperature (oC) | 69.1 | |
Target gene | Human TRACP 5a and 5b gene | |
siRNA concentration | 1 nM | |
Cell or Organism used | CHO cells | |
Transfection method | Mirus Trans IT TKO (MirusBio, USA) | |
Duration after transfection | 45 Hours | |
Article title | RNA interference tolerates 2'-fluoro modifications at the Argonaute2 cleavage site |
|
Reference | 17511001 |