| Field | Sense | Antisense |
| siRNA chemical modification | 0 | Mutation* 5-O-Methyl |
| siRNA modification types | 0 | 2 |
| Overall number of modifications | 0 | 2 |
| Position of modifications | 0 | 1 * 1 |
| Modification on sugar or base or phosphate | 0 | Base; Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
- COCC1OCC(O)C1O |
| siRNA Sequence | CGUACGCGGAAUACUUCGAUU | TCGAAGUAUUCCGCGUACGUU |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | s/meT-as | s/meT-as |
| Biological activity | 20 percent target mRNA inhibition | |
| Experiment used to check activity | Dual luciferase reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | Luciferase gene | |
| siRNA concentration | 25 nM | |
| Cell or Organism used | HeLa and HEK293 cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 24 Hours | |
| Article title | Strand-specific 5'-O-methylation of siRNA duplexes controls guide strand selection and targeting specificity |
|
| Reference | 18094121 | |