| Field | Sense | Antisense |
| siRNA chemical modification | 0 | Locked nucleic acid |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 2 |
| Position of modifications | 0 | 20,21 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
OCC12COC(CO1)C2O |
| siRNA Sequence | UUCUCCGAACGUGUCACGUUU | ACGUGACACGUUCGGAGAAUUU |
| siRNA length base-pair | 21 | 22 |
| siRNA name in paper | mod 13 | mod 13 |
| Biological activity | 2.8 (log-10 CVB-3 titre pfu/ml) | |
| Experiment used to check activity | Viral titre | |
| Melting temperature (oC) | NA | |
| Target gene | RNA dependent RNA polymerase (RdRP) gene of CVB-3 | |
| siRNA concentration | 10 nM | |
| Cell or Organism used | Vero and COS7 cells | |
| Transfection method | CVB-3 at a multiplicity of infection (m.o.i.) of 0.1 | |
| Duration after transfection | 19 Hours | |
| Article title | Application of small interfering RNAs modified by unlocked nucleic acid (UNA) to inhibit the heart-pathogenic coxsackievirus B3 |
|
| Reference | 20005874 | |