| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 2,4-Carbocyclic-Ethylene-bridged nucleic acid-Locked nucleic acid |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 3 |
| Position of modifications | 0 | 3 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
OCC12CCCC(CO1)C2O |
| siRNA Sequence | GACGUAAACGGCCACAAGUUC | ACUUGUGGCCGUUUACGUCGC |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | CENA modified | CENA modified |
| Biological activity | High target mRNA inhibition efficacy | |
| Experiment used to check activity | Northern Blot | |
| Melting temperature (oC) | NA | |
| Target gene | EGFP gene | |
| siRNA concentration | 1 nM | |
| Cell or Organism used | MiaPaca II cells | |
| Transfection method | Lipofectamin 2013 | |
| Duration after transfection | 24 Hours | |
| Article title | In vivo efficacy and off-target effects of locked nucleic acid (LNA) and unlocked nucleic acid (UNA) modified siRNA and small internally segmented interfering RNA (sisiRNA) in mice bearing human tumor xenografts |
|
| Reference | 21687525 | |