Field | Sense | Antisense |
siRNA chemical modification | Locked nucleic acid* Small internally segmented RNA | Locked nucleic acid |
siRNA modification types | 2 | 1 |
Overall number of modifications | 7 | 2 |
Position of modifications | 3,9,13,15,20,21 * 14 | 20,21 |
Modification on sugar or base or phosphate | Sugar | Sugar |
SMILES (Click to view structure & nomenclature) |
OCC12COC(CO1)C2O |
OCC12COC(CO1)C2O |
siRNA Sequence | GACGUAAACGGCCACAAGUTC | ACUUGUGGCCGUUUACGUCGC |
siRNA length base-pair | 21 | 21 |
siRNA name in paper | sisiRNA | sisiRNA |
Biological activity | High target mRNA inhibition efficacy | |
Experiment used to check activity | Northern Blot | |
Melting temperature (oC) | NA | |
Target gene | EGFP gene | |
siRNA concentration | 5 nM | |
Cell or Organism used | MiaPaca II cells | |
Transfection method | Lipofectamin 2023 | |
Duration after transfection | 24 Hours | |
Article title | In vivo efficacy and off-target effects of locked nucleic acid (LNA) and unlocked nucleic acid (UNA) modified siRNA and small internally segmented interfering RNA (sisiRNA) in mice bearing human tumor xenografts |
|
Reference | 21687525 |