| Field | Sense | Antisense |
| siRNA chemical modification | UnLocked nucleic acid | Unlocked nucleic acid * Locked nucleic acid |
| siRNA modification types | 1 | 2 |
| Overall number of modifications | 1 | 3 |
| Position of modifications | 21 | 6 * 20,21 |
| Modification on sugar or base or phosphate | Sugar | Sugar |
| SMILES (Click to view structure & nomenclature) |
OCCOC(CO)CO |
OCCOC(CO)CO |
| siRNA Sequence | GACGUAAACGGCCACAAGUUUU | ACUUGUGGCCGUUUACGUCGCU |
| siRNA length base-pair | 22 | 22 |
| siRNA name in paper | UNA modified 2 | UNA modified 2 |
| Biological activity | High target mRNA inhibition efficacy | |
| Experiment used to check activity | Northern Blot | |
| Melting temperature (oC) | NA | |
| Target gene | EGFP gene | |
| siRNA concentration | 5 nM | |
| Cell or Organism used | MiaPaca II cells | |
| Transfection method | Lipofectamin 2027 | |
| Duration after transfection | 24 Hours | |
| Article title | In vivo efficacy and off-target effects of locked nucleic acid (LNA) and unlocked nucleic acid (UNA) modified siRNA and small internally segmented interfering RNA (sisiRNA) in mice bearing human tumor xenografts |
|
| Reference | 21687525 | |