Field | Sense | Antisense |
siRNA chemical modification | 0 | 2,4-Carbocyclic-Ethylene-bridged nucleic acid-Locked nucleic acid |
siRNA modification types | 0 | 1 |
Overall number of modifications | 0 | 3 |
Position of modifications | 0 | 3 |
Modification on sugar or base or phosphate | 0 | Sugar |
SMILES (Click to view structure & nomenclature) |
- |
OCC12CCCC(CO1)C2O |
siRNA Sequence | GACGUAAACGGCCACAAGUUC | ACUUGUGGCCGUUUACGUCGC |
siRNA length base-pair | 21 | 21 |
siRNA name in paper | CENA modified | CENA modified |
Biological activity | High target mRNA inhibition efficacy | |
Experiment used to check activity | Northern Blot | |
Melting temperature (oC) | NA | |
Target gene | EGFP gene | |
siRNA concentration | 25 nM | |
Cell or Organism used | MiaPaca II cells | |
Transfection method | Lipofectamin 2045 | |
Duration after transfection | 24 Hours | |
Article title | In vivo efficacy and off-target effects of locked nucleic acid (LNA) and unlocked nucleic acid (UNA) modified siRNA and small internally segmented interfering RNA (sisiRNA) in mice bearing human tumor xenografts |
|
Reference | 21687525 |