| Field | Sense | Antisense |
| siRNA chemical modification | UnLocked nucleic acid | Unlocked nucleic acid |
| siRNA modification types | 1 | 1 |
| Overall number of modifications | 1 | 1 |
| Position of modifications | 21 | 21 |
| Modification on sugar or base or phosphate | Sugar | Sugar |
| SMILES (Click to view structure & nomenclature) |
OCCOC(CO)CO |
OCCOC(CO)CO |
| siRNA Sequence | GACGUAAACGGCCACAAGUUUU | ACUUGUGGCCGUUUACGUCGUU |
| siRNA length base-pair | 22 | 22 |
| siRNA name in paper | UNA modified 1 | UNA modified 1 |
| Biological activity | High target mRNA inhibition efficacy | |
| Experiment used to check activity | Northern and Western Blot | |
| Melting temperature (oC) | NA | |
| Target gene | EGFP gene | |
| siRNA concentration | 0.25 mg/kg/day | |
| Cell or Organism used | EGFP (mRNA) tumor xenografts NMRI nu/nu mice | |
| Transfection method | Osmotic minipumps | |
| Duration after transfection | 24 Hours | |
| Article title | In vivo efficacy and off-target effects of locked nucleic acid (LNA) and unlocked nucleic acid (UNA) modified siRNA and small internally segmented interfering RNA (sisiRNA) in mice bearing human tumor xenografts |
|
| Reference | 21687525 | |