SM2938 Chemically modified siRNA information

Field Sense Antisense
siRNA chemical modification 0 2,4-Carbocyclic-Ethylene-bridged nucleic acid-Locked nucleic acid
siRNA modification types 0 1
Overall number of modifications 0 3
Position of modifications 0 3
Modification on sugar or base or phosphate 0 Sugar
SMILES
(Click to view structure & nomenclature)
-



OCC12CCCC(CO1)C2O



siRNA Sequence GACGUAAACGGCCACAAGUUC ACUUGUGGCCGUUUACGUCGC
siRNA length base-pair 21 21
siRNA name in paper CENA modified CENA modified
Biological activity High target mRNA inhibition efficacy
Experiment used to check activity Northern and Western Blot
Melting temperature (oC) NA
Target gene EGFP gene
siRNA concentration 0.25 mg/kg/day
Cell or Organism used EGFP (mRNA) tumor xenografts NMRI nu/nu mice
Transfection method Osmotic minipumps
Duration after transfection 24 Hours
Article title In vivo efficacy and off-target effects of locked nucleic acid (LNA) and unlocked nucleic acid (UNA) modified siRNA and small internally segmented interfering RNA (sisiRNA) in mice bearing human tumor xenografts
Reference21687525