| Field | Sense | Antisense |
| siRNA chemical modification | Locked nucleic acid* Small internally segmented RNA | Locked nucleic acid |
| siRNA modification types | 2 | 1 |
| Overall number of modifications | 7 | 6 |
| Position of modifications | 3,9,13,15,20,21 * 10 | 3,6,14,18,20,21 |
| Modification on sugar or base or phosphate | Sugar; Phosphate | Sugar |
| SMILES (Click to view structure & nomenclature) |
OCC12COC(CO1)C2O |
OCC12COC(CO1)C2O |
| siRNA Sequence | GACGUAAACGGCCACAAGUUC | ACUUGUGGCCGUUUACGUCGC |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | W179 | W209 |
| Biological activity | 63 percent target mRNA inhibition | |
| Experiment used to check activity | Dual luciferase reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | EGFP gene | |
| siRNA concentration | 10 nM | |
| Cell or Organism used | H1299 cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 48 Hours | |
| Article title | In vivo screening of modified siRNAs for non-specific antiviral effect in a small fish model: number and localization in the strands are important |
|
| Reference | 22287630 | |