| Field | Sense | Antisense |
| siRNA chemical modification | 0 | O-Methyl |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 21 |
| Position of modifications | 0 | 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,22 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
COC1C(O)OC(CO)C1O |
| siRNA Sequence | GACGUAAACGGCCACAAGUUCU | ACUUGUGGCCGUUUACGUCGCU |
| siRNA length base-pair | 22 | 22 |
| siRNA name in paper | W207 | W106 |
| Biological activity | 75 percent target mRNA inhibition | |
| Experiment used to check activity | Dual luciferase reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | EGFP gene | |
| siRNA concentration | 10 nM | |
| Cell or Organism used | H1299 cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 48 Hours | |
| Article title | In vivo screening of modified siRNAs for non-specific antiviral effect in a small fish model: number and localization in the strands are important |
|
| Reference | 22287630 | |