| Field | Sense | Antisense |
| siRNA chemical modification | Locked nucleic acid | Locked nucleic acid |
| siRNA modification types | 1 | 1 |
| Overall number of modifications | 2 | 2 |
| Position of modifications | 20,21 | 20,21 |
| Modification on sugar or base or phosphate | Sugar | Sugar |
| SMILES (Click to view structure & nomenclature) |
OCC12COC(CO1)C2O |
OCC12COC(CO1)C2O |
| siRNA Sequence | GACGUAAACGGCCACAAGUUCU | ACUUGUGGCCGUUUACGUCGCU |
| siRNA length base-pair | 22 | 22 |
| siRNA name in paper | W194 | W208 |
| Biological activity | 92 percent target mRNA inhibition | |
| Experiment used to check activity | Dual luciferase reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | EGFP gene | |
| siRNA concentration | 10 nM | |
| Cell or Organism used | H1299 cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 48 Hours | |
| Article title | In vivo screening of modified siRNAs for non-specific antiviral effect in a small fish model: number and localization in the strands are important |
|
| Reference | 22287630 | |