Field | Sense | Antisense |
siRNA chemical modification | Phosphorothioate | 0 |
siRNA modification types | 1 | 0 |
Overall number of modifications | 6 | 0 |
Position of modifications | 4,6,7,14,15,19 | 0 |
Modification on sugar or base or phosphate | Phosphate | 0 |
SMILES (Click to view structure & nomenclature) |
OCC1OCC(O)C1OP(O)(S)=O |
- |
siRNA Sequence | GUUCACCUUGAUGCCGUUCUU | GAACGGCAUCAAGGUGAACUU |
siRNA length base-pair | 21 | 21 |
siRNA name in paper | EGFP1 ATCSN | EGFP1 ATCSN |
Biological activity | 85 percent target mRNA inhibition | |
Experiment used to check activity | FACS and cellular RNA analysis | |
Melting temperature (oC) | NA | |
Target gene | EGFP gene | |
siRNA concentration | 25 nM | |
Cell or Organism used | HeLa cells | |
Transfection method | Oligofectamine (Invitrogen) | |
Duration after transfection | 54 Hours | |
Article title | RNA interference using boranophosphate siRNAs: structure-activity relationships |
|
Reference | 15545637 |