| Field | Sense | Antisense |
| siRNA chemical modification | Boranophosphate | 0 |
| siRNA modification types | 1 | 0 |
| Overall number of modifications | 9 | 0 |
| Position of modifications | 2,3,8,9,12,17,18,20,21 | 0 |
| Modification on sugar or base or phosphate | Phosphate | 0 |
| SMILES (Click to view structure & nomenclature) |
BP(O)(=O)OC1C(O)COC1CO |
- |
| siRNA Sequence | GUUCACCUUGAUGCCGUUCUU | GAACGGCAUCAAGGUGAACUU |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | EGFP1 ABUSN | EGFP1 ABUSN |
| Biological activity | 70 percent target mRNA inhibition | |
| Experiment used to check activity | FACS and cellular RNA analysis | |
| Melting temperature (oC) | NA | |
| Target gene | EGFP gene | |
| siRNA concentration | 25 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Oligofectamine (Invitrogen) | |
| Duration after transfection | 54 Hours | |
| Article title | RNA interference using boranophosphate siRNAs: structure-activity relationships |
|
| Reference | 15545637 | |