| Field | Sense | Antisense |
| siRNA chemical modification | 0 | Phosphorothioate |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 4 |
| Position of modifications | 0 | 4,7,10,19 |
| Modification on sugar or base or phosphate | 0 | Phosphate |
| SMILES (Click to view structure & nomenclature) |
- |
OCC1OCC(O)C1OP(O)(S)=O |
| siRNA Sequence | GUUCACCUUGAUGCCGUUCUU | GAACGGCAUCAAGGUGAACUU |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | EGFP1 ANSTC | EGFP1 ANSTC |
| Biological activity | 58 percent target mRNA inhibition | |
| Experiment used to check activity | FACS and cellular RNA analysis | |
| Melting temperature (oC) | NA | |
| Target gene | EGFP gene | |
| siRNA concentration | 25 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Oligofectamine (Invitrogen) | |
| Duration after transfection | 54 Hours | |
| Article title | RNA interference using boranophosphate siRNAs: structure-activity relationships |
|
| Reference | 15545637 | |