| Field | Sense | Antisense |
| siRNA chemical modification | 0 | Locked nucleic acid |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 6 |
| Position of modifications | 0 | 1,7,10,16,20,21 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
OCC12COC(CO1)C2O |
| siRNA Sequence | CUUACGCUGAGUACUUCGATT | TCGAAGTACTCAGCGTAAGTT |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | siLNA11 | siLNA11 |
| Biological activity | 19 percent target mRNA inhibition | |
| Experiment used to check activity | Luciferase reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | Luciferase gene | |
| siRNA concentration | 13 nM | |
| Cell or Organism used | HEK293, rat PC12 and Vero cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 24 Hours | |
| Article title | Locked nucleic acid (LNA) mediated improvements in siRNA stability and functionality |
|
| Reference | 15653644 | |