Field | Sense | Antisense |
siRNA chemical modification | Locked nucleic acid | 0 |
siRNA modification types | 1 | 0 |
Overall number of modifications | 3 | 0 |
Position of modifications | 1,20,21 | 0 |
Modification on sugar or base or phosphate | Sugar | 0 |
SMILES (Click to view structure & nomenclature) |
OCC12COC(CO1)C2O |
- |
siRNA Sequence | TGAGAGAAAGCACAGAAAATT | UUUUCUGUGCUUUCUCUCATT |
siRNA length base-pair | 21 | 21 |
siRNA name in paper | siLNA18 | siLNA18 |
Biological activity | 74 percent target mRNA inhibition | |
Experiment used to check activity | Luciferase reporter assay | |
Melting temperature (oC) | NA | |
Target gene | Luciferase gene | |
siRNA concentration | 13 nM | |
Cell or Organism used | HEK293, rat PC12 and Vero cells | |
Transfection method | Lipofectamine 2000 | |
Duration after transfection | 24 Hours | |
Article title | Locked nucleic acid (LNA) mediated improvements in siRNA stability and functionality |
|
Reference | 15653644 |