| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 2-Deoxy-2-Fluoro-4-Thioarabinonucleic acid |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 2 |
| Position of modifications | 0 | 1,2 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
OCC1SCC(F)C1O |
| siRNA Sequence | GCUUGAAGUCUUUAAUUAATT | UUAAUUAAAGACUUCAAGCGG |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | T3P | T3P |
| Biological activity | IC-50 = 0.16 nM for target mRNA | |
| Experiment used to check activity | Luciferase reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | Luciferase gene | |
| siRNA concentration | 1.16 nM | |
| Cell or Organism used | HeLa X1/5 cells | |
| Transfection method | Lipofectamine-plus reagent (Invitrogen) | |
| Duration after transfection | 24 Hours | |
| Article title | 2'-fluoro-4'-thioarabino-modified oligonucleotides: conformational switches linked to siRNA activity |
|
| Reference | 17284457 | |