Field | Sense | Antisense |
siRNA chemical modification | 2-Deoxy-2-Fluoroarabinonucleic acid | 0 |
siRNA modification types | 1 | 0 |
Overall number of modifications | 21 | 0 |
Position of modifications | 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21 | 0 |
Modification on sugar or base or phosphate | Sugar | 0 |
SMILES (Click to view structure & nomenclature) |
OCC1OC(O)C(F)C1O |
- |
siRNA Sequence | GCTTGAAGTCTTTAATTAAGG | UUAAUUAAAGACUUCAAGCGG |
siRNA length base-pair | 21 | 21 |
siRNA name in paper | Ctl-f | Ctl-f |
Biological activity | IC-50 = 7.8 nM for target mRNA | |
Experiment used to check activity | Luciferase reporter assay | |
Melting temperature (oC) | 66 | |
Target gene | Luciferase gene | |
siRNA concentration | 7.8 nM | |
Cell or Organism used | HeLa X1/5 cells | |
Transfection method | Lipofectamine-plus reagent (Invitrogen) | |
Duration after transfection | 24 Hours | |
Article title | 2'-fluoro-4'-thioarabino-modified oligonucleotides: conformational switches linked to siRNA activity |
|
Reference | 17284457 |