| Field | Sense | Antisense |
| siRNA chemical modification | 2-Deoxy-2-Fluoroarabinonucleic acid | 2-Deoxy-2-Fluoroarabinonucleic acid |
| siRNA modification types | 1 | 1 |
| Overall number of modifications | 16 | 1 |
| Position of modifications | 1,2,3,4,5,6,7,8,9,10,11,12,13,14,20,21 | 13 |
| Modification on sugar or base or phosphate | Sugar | Sugar |
| SMILES (Click to view structure & nomenclature) |
OCC1OC(O)C(F)C1O |
C1C(C(C(O1)CO)O)F |
| siRNA Sequence | GCTTGAAGTCTTTAATTAATT | UUAAUUAAAGACTUCAAGCGG |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | F2-fr | F2-fr |
| Biological activity | IC-50 = 0.87 nM for target mRNA | |
| Experiment used to check activity | Luciferase reporter assay | |
| Melting temperature (oC) | 61.6 | |
| Target gene | Luciferase gene | |
| siRNA concentration | 0.87 nM | |
| Cell or Organism used | HeLa X1/5 cells | |
| Transfection method | Lipofectamine-plus reagent (Invitrogen) | |
| Duration after transfection | 24 Hours | |
| Article title | 2'-fluoro-4'-thioarabino-modified oligonucleotides: conformational switches linked to siRNA activity |
|
| Reference | 17284457 | |