| Field | Sense | Antisense |
| siRNA chemical modification | 2-O-Methyl | 0 |
| siRNA modification types | 1 | 0 |
| Overall number of modifications | 12 | 0 |
| Position of modifications | 1,3,6,7,8,9,12,13,15,16,17,18 | 0 |
| Modification on sugar or base or phosphate | Sugar | 0 |
| SMILES (Click to view structure & nomenclature) |
COC1C(O)OC(CO)C1O |
- |
| siRNA Sequence | GCACCAGAGCCAAUGGAACUUGATG | CAUCAAGUUCCAUUGGCUCUGGUGCUU |
| siRNA length base-pair | 25 | 27 |
| siRNA name in paper | STAT1-7 | STAT1-7 |
| Biological activity | 85 percent target mRNA inhibition | |
| Experiment used to check activity | Real-time PCR | |
| Melting temperature (oC) | NA | |
| Target gene | STAT1 gene | |
| siRNA concentration | 1 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | TriFECTin (Integrated DNA Technologies, Coralville, IA) | |
| Duration after transfection | 24 Hours | |
| Article title | Chemical modification patterns compatible with high potency dicer-substrate small interfering RNAs |
|
| Reference | 18637735 | |