| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 2-Fluoro |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 13 |
| Position of modifications | 0 | 8,9,10,11,13,14,17,18,19,20,23,25,26 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
OCC1OCC(F)C1O |
| siRNA Sequence | GCACCAGAGCCAAUGGAACUUGATG | CAUCAAGUUCCAUUGGCUCUGGUGCUU |
| siRNA length base-pair | 25 | 27 |
| siRNA name in paper | STAT1-11 | STAT1-11 |
| Biological activity | 14 percent target mRNA inhibition | |
| Experiment used to check activity | Real-time PCR | |
| Melting temperature (oC) | NA | |
| Target gene | STAT1 gene | |
| siRNA concentration | 0.1 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | TriFECTin (Integrated DNA Technologies, Coralville, IA) | |
| Duration after transfection | 24 Hours | |
| Article title | Chemical modification patterns compatible with high potency dicer-substrate small interfering RNAs |
|
| Reference | 18637735 | |