Field | Sense | Antisense |
siRNA chemical modification | Conjugation bulky group | 0 |
siRNA modification types | 1 | 0 |
Overall number of modifications | 1 | 0 |
Position of modifications | 1 | 0 |
Modification on sugar or base or phosphate | Phosphate | 0 |
SMILES (Click to view structure & nomenclature) |
- |
- |
siRNA Sequence | GCACGAAUCCUAAACCUCACAAUAUGAGGUUUAGGAUUCGUGCUU | 0 |
siRNA length base-pair | 45 | 0 |
siRNA name in paper | SG146 | 0 |
Biological activity | 60 percent target mRNA inhibition | |
Experiment used to check activity | Luciferase activity (MicroLumat LB 96P) | |
Melting temperature (oC) | NA | |
Target gene | Luciferase gene | |
siRNA concentration | 20 nM | |
Cell or Organism used | HEK293 cells | |
Transfection method | Lipofectamine 2000 | |
Duration after transfection | 48 Hours | |
Article title | Effects of chemical modification on the potency, serum stability, and immunostimulatory properties of short shRNAs |
|
Reference | 19948766 |