| Field | Sense | Antisense |
| siRNA chemical modification | Conjugation bulky group | 0 |
| siRNA modification types | 1 | 0 |
| Overall number of modifications | 1 | 0 |
| Position of modifications | 1 | 0 |
| Modification on sugar or base or phosphate | Phosphate | 0 |
| SMILES (Click to view structure & nomenclature) |
- |
- |
| siRNA Sequence | GCACGAAUCCUAAACCUCACAAUAUGAGGUUUAGGAUUCGUGCUU | 0 |
| siRNA length base-pair | 45 | 0 |
| siRNA name in paper | SG146 | 0 |
| Biological activity | 60 percent target mRNA inhibition | |
| Experiment used to check activity | Luciferase activity (MicroLumat LB 96P) | |
| Melting temperature (oC) | NA | |
| Target gene | Luciferase gene | |
| siRNA concentration | 20 nM | |
| Cell or Organism used | HEK293 cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 48 Hours | |
| Article title | Effects of chemical modification on the potency, serum stability, and immunostimulatory properties of short shRNAs |
|
| Reference | 19948766 | |