| Field | Sense | Antisense |
| siRNA chemical modification | Phosphodiester | Phosphodiester |
| siRNA modification types | 1 | 1 |
| Overall number of modifications | 1 | 1 |
| Position of modifications | 7 | 14 |
| Modification on sugar or base or phosphate | Sugar | Sugar |
| SMILES (Click to view structure & nomenclature) |
OP(O)(O)=O |
OP(O)(O)=O |
| siRNA Sequence | AGCGCUUAAAGGGCGAGAAGAUU | UCUUCUCGCCCUUUAAGCGCUUU |
| siRNA length base-pair | 23 | 23 |
| siRNA name in paper | 1-3U | 1-3U |
| Biological activity | 45 percent target mRNA inhibition | |
| Experiment used to check activity | Dual luciferase reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | Human KAZRIN gene | |
| siRNA concentration | 13 nM | |
| Cell or Organism used | HEK293 cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 4 Hours | |
| Article title | Modified oligo-nucleic acid molecule, preparation method and uses thereof |
|
| Reference | US20120088815A1, EP2415869A1 | |