Field | Sense | Antisense |
siRNA chemical modification | 0 | 2-Deoxy-2-Fluoro |
siRNA modification types | 0 | 1 |
Overall number of modifications | 0 | 7 |
Position of modifications | 0 | 4,5,7,13,16,20,21 |
Modification on sugar or base or phosphate | 0 | Sugar |
SMILES (Click to view structure & nomenclature) |
- |
OCC1OCC(F)C1O |
siRNA Sequence | AACCCACCACAGCUAGAACUU | AAGUUCUAGCUGUGGUGGGUU |
siRNA length base-pair | 21 | 21 |
siRNA name in paper | 2-3O | 2-3O |
Biological activity | 14 percent target mRNA inhibition | |
Experiment used to check activity | Dual luciferase reporter assay | |
Melting temperature (oC) | NA | |
Target gene | 0 | |
siRNA concentration | 13 nM | |
Cell or Organism used | HEK293 cells | |
Transfection method | Lipofectamine 2000 | |
Duration after transfection | 4 Hours | |
Article title | Modified oligo-nucleic acid molecule, preparation method and uses thereof |
|
Reference | US20120088815A1, EP2415869A1 |