| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 2-O-Methyl ribose |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 4 |
| Position of modifications | 0 | 1,2,22,23 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
COC1C(O)OC(CO)C1O |
| siRNA Sequence | AACCUUACCCACCUCAUGUAUCU | AGAUACAUGAGGUGGGUAAGGUU |
| siRNA length base-pair | 23 | 23 |
| siRNA name in paper | S | OMe-A53 |
| Biological activity | 62 percent target mRNA inhibition | |
| Experiment used to check activity | Dual luciferase assay | |
| Melting temperature (oC) | NA | |
| Target gene | Firefly luciferase expression | |
| siRNA concentration | 17 nM | |
| Cell or Organism used | 293FT cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 48 Hours | |
| Article title | Enhancement of stability and activity of siRNA by terminal substitution with serinol nucleic acid (SNA) |
|
| Reference | 25233814 | |