| Field | Sense | Antisense |
| siRNA chemical modification | 0 | Phosphorothioate |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 21 |
| Position of modifications | 0 | 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
OCC1OCC(O)C1OP(O)(S)=O |
| siRNA Sequence | AAGUAAGGACCAGAGACAAA | UUUGUCUCUGGUCCUUACUU |
| siRNA length base-pair | 20 | 20 |
| siRNA name in paper | 2 | 3 |
| Biological activity | 30 percent target mRNA inhibition | |
| Experiment used to check activity | Real-time PCR | |
| Melting temperature (oC) | NA | |
| Target gene | PTEN mRNA | |
| siRNA concentration | 1.5 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Lipofectin | |
| Duration after transfection | 20 Hours | |
| Article title | Positional effect of chemical modifications on short interference RNA activity in mammalian cells |
|
| Reference | 15974578 | |