Field | Sense | Antisense |
siRNA chemical modification | 0 | 2-O-Methyl |
siRNA modification types | 0 | 1 |
Overall number of modifications | 0 | 3 |
Position of modifications | 0 | 1,2,3 |
Modification on sugar or base or phosphate | 0 | Sugar |
SMILES (Click to view structure & nomenclature) |
- |
COC1C(O)OC(CO)C1O |
siRNA Sequence | AAGUAAGGACCAGAGACAAA | UUUGUCUCUGGUCCUUACUU |
siRNA length base-pair | 20 | 20 |
siRNA name in paper | 2 | 4 |
Biological activity | 19 percent target mRNA inhibition | |
Experiment used to check activity | Real-time PCR | |
Melting temperature (oC) | NA | |
Target gene | PTEN mRNA | |
siRNA concentration | 1.5 nM | |
Cell or Organism used | HeLa cells | |
Transfection method | Lipofectin | |
Duration after transfection | 20 Hours | |
Article title | Positional effect of chemical modifications on short interference RNA activity in mammalian cells |
|
Reference | 15974578 |