| Field | Sense | Antisense |
| siRNA chemical modification | 2-O-(2-methoxyethyl)ribose | 0 |
| siRNA modification types | 1 | 0 |
| Overall number of modifications | 3 | 0 |
| Position of modifications | 12,13,14 | 0 |
| Modification on sugar or base or phosphate | Sugar | 0 |
| SMILES (Click to view structure & nomenclature) |
COCCOC1COC(CO)C1O |
- |
| siRNA Sequence | AAGUAAGGACCAGAGACAAA | UUUGUCUCUGGUCCUUACUU |
| siRNA length base-pair | 20 | 20 |
| siRNA name in paper | 34 | 1 |
| Biological activity | 77 percent target mRNA inhibition | |
| Experiment used to check activity | Real-time PCR | |
| Melting temperature (oC) | NA | |
| Target gene | PTEN mRNA | |
| siRNA concentration | 20 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Lipofectin | |
| Duration after transfection | 20 Hours | |
| Article title | Positional effect of chemical modifications on short interference RNA activity in mammalian cells |
|
| Reference | 15974578 | |