Field | Sense | Antisense |
siRNA chemical modification | Palmitic acid | 0 |
siRNA modification types | 1 | 0 |
Overall number of modifications | 1 | 0 |
Position of modifications | 1 | 0 |
Modification on sugar or base or phosphate | Phosphate | 0 |
SMILES (Click to view structure & nomenclature) |
CCCCCCCCCCCCCCCC(=O)NCCCCCCO |
- |
siRNA Sequence | UCCUACAGCACAACAAAUGUG | CAUUUGUUGUGCUGUAGGAAG |
siRNA length base-pair | 21 | 21 |
siRNA name in paper | C16-siVEGF | C16-siVEGF |
Biological activity | 83 percent target mRNA inhibition | |
Experiment used to check activity | Real-time PCR | |
Melting temperature (oC) | NA | |
Target gene | vascular endothelial growth factor (VEGF) gene | |
siRNA concentration | 50 uM | |
Cell or Organism used | HeLa cells | |
Transfection method | Lipofectamine 2000 | |
Duration after transfection | 48 Hours | |
Article title | Palmitic acid-conjugated 21-nucleotide siRNA enhances gene-silencing activity |
|
Reference | 21985606 |