| Field | Sense | Antisense |
| siRNA chemical modification | Palmitic acid | 0 |
| siRNA modification types | 1 | 0 |
| Overall number of modifications | 1 | 0 |
| Position of modifications | 1 | 0 |
| Modification on sugar or base or phosphate | Phosphate | 0 |
| SMILES (Click to view structure & nomenclature) |
CCCCCCCCCCCCCCCC(=O)NCCCCCCO |
- |
| siRNA Sequence | UCCUACAGCACAACAAAUGUG | CAUUUGUUGUGCUGUAGGAAG |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | C16-siVEGF | C16-siVEGF |
| Biological activity | 48 percent target mRNA inhibition | |
| Experiment used to check activity | Real-time PCR | |
| Melting temperature (oC) | NA | |
| Target gene | vascular endothelial growth factor (VEGF) gene | |
| siRNA concentration | 50 uM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 120 Hours | |
| Article title | Palmitic acid-conjugated 21-nucleotide siRNA enhances gene-silencing activity |
|
| Reference | 21985606 | |