| Field | Sense | Antisense |
| siRNA chemical modification | 2-Deoxyribonucleotide | 0 |
| siRNA modification types | 1 | 0 |
| Overall number of modifications | 2 | 0 |
| Position of modifications | 24,25 | 0 |
| Modification on sugar or base or phosphate | Sugar | 0 |
| SMILES (Click to view structure & nomenclature) |
OCC1OCCC1O |
- |
| siRNA Sequence | GGCCUUUCACUACUCCUACGAGCAC | GUGCUCGUAGGAGUAGUGAAAGGCCAG |
| siRNA length base-pair | 25 | 27 |
| siRNA name in paper | DsiRNA-A | DsiRNA-A |
| Biological activity | 70 percent target mRNA inhibition | |
| Experiment used to check activity | Luciferase gene reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | Renilla luciferase gene | |
| siRNA concentration | 0.2 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 48 Hours | |
| Article title | Amino-modified and lipid-conjugated dicer-substrate siRNA enhances RNAi efficacy |
|
| Reference | 22236254 | |