Field | Sense | Antisense |
siRNA chemical modification | Cholesterol | 0 |
siRNA modification types | 1 | 0 |
Overall number of modifications | 1 | 0 |
Position of modifications | 1 | 0 |
Modification on sugar or base or phosphate | Phosphate | 0 |
SMILES (Click to view structure & nomenclature) |
CC(C)CCCC(C)C1CCC2C3CC=C4CC(O)CCC4(C)C3CCC12C |
- |
siRNA Sequence | CUGGCCUUUCACUACUCCUACGAGCAC | GUGCUCGUAGGAGUAGUGAAAGGCCAG |
siRNA length base-pair | 27 | 27 |
siRNA name in paper | Chol-ss27Luc | Chol-ss27Luc |
Biological activity | NA | |
Experiment used to check activity | Dual-Glo Luciferase Assay System | |
Melting temperature (oC) | NA | |
Target gene | Luciferase | |
siRNA concentration | NA | |
Cell or Organism used | HeLa cells | |
Transfection method | Lipofectamine 2000 | |
Duration after transfection | 48 Hours | |
Article title | Lipid-conjugated 27-nucleotide double-stranded RNAs with dicer-substrate potency enhance RNAi-mediated gene silencing |
|
Reference | 22494497 |