| Field | Sense | Antisense |
| siRNA chemical modification | Cholesterol | 0 |
| siRNA modification types | 1 | 0 |
| Overall number of modifications | 1 | 0 |
| Position of modifications | 1 | 0 |
| Modification on sugar or base or phosphate | Phosphate | 0 |
| SMILES (Click to view structure & nomenclature) |
CC(C)CCCC(C)C1CCC2C3CC=C4CC(O)CCC4(C)C3CCC12C |
- |
| siRNA Sequence | CUGGCCUUUCACUACUCCUACGAGCAC | GUGCUCGUAGGAGUAGUGAAAGGCCAG |
| siRNA length base-pair | 27 | 27 |
| siRNA name in paper | Chol-ds27Luc | Chol-ds27Luc |
| Biological activity | 10 percent target mRNA inhibition | |
| Experiment used to check activity | Dual-Glo Luciferase Assay System | |
| Melting temperature (oC) | NA | |
| Target gene | Renilla luciferase gene | |
| siRNA concentration | 50 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | No transfection agent | |
| Duration after transfection | 48 Hours | |
| Article title | Lipid-conjugated 27-nucleotide double-stranded RNAs with dicer-substrate potency enhance RNAi-mediated gene silencing |
|
| Reference | 22494497 | |