| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 2-O-Methylribose |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 6 |
| Position of modifications | 0 | 6,12,15,18,19,20 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
COC1C(O)OC(CO)C1O |
| siRNA Sequence | CAUUGGUGAAGGAUCCAGGA | UCCUGGAUCCUUCACCAAUG |
| siRNA length base-pair | 20 | 20 |
| siRNA name in paper | 338939 | 345838 |
| Biological activity | IC-50 = 0.022859 nM for target mRNA | |
| Experiment used to check activity | RT-PCR | |
| Melting temperature (oC) | NA | |
| Target gene | eIF4E | |
| siRNA concentration | 50 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | LIPOFECTIN | |
| Duration after transfection | 16 Hours | |
| Article title | Positionally modified siRNA constructs |
|
| Reference | US 8394947 B2 | |