Field | Sense | Antisense |
siRNA chemical modification | 0 | 2-O-methoxyethylribose |
siRNA modification types | 0 | 1 |
Overall number of modifications | 0 | 3 |
Position of modifications | 0 | 4,10,19 |
Modification on sugar or base or phosphate | 0 | Sugar |
SMILES (Click to view structure & nomenclature) |
- |
COCCOC1CSC(CO)C1O |
siRNA Sequence | AAGUAAGGACCAGAGACAA | UUUGUCUCUGGUCCUUACUU |
siRNA length base-pair | 19 | 20 |
siRNA name in paper | 348458 | 357275 |
Biological activity | 83 percent target mRNA inhibition | |
Experiment used to check activity | RT-PCR | |
Melting temperature (oC) | NA | |
Target gene | PTEN | |
siRNA concentration | 50 nM | |
Cell or Organism used | HeLa cells | |
Transfection method | LIPOFECTIN | |
Duration after transfection | 16 Hours | |
Article title | Positionally modified siRNA constructs |
|
Reference | US 8394947 B2 |