Field | Sense | Antisense |
siRNA chemical modification | 0 | unlocked nucleic acid |
siRNA modification types | 0 | 1 |
Overall number of modifications | 0 | 1 |
Position of modifications | 0 | 1 |
Modification on sugar or base or phosphate | 0 | Sugar |
SMILES (Click to view structure & nomenclature) |
- |
OCCOC(CO)CO |
siRNA Sequence | UGAAUCAGAAGAUGAAGUCAA | GACUUCAUCUUCUGAUUCAAG |
siRNA length base-pair | 21 | 21 |
siRNA name in paper | 5AS_UsiH5 | 5AS_UsiH5 |
Biological activity | 94 percent target mRNA inhibition | |
Experiment used to check activity | Dual luciferase assay | |
Melting temperature (oC) | NA | |
Target gene | Sensor for AS strand luciferase gene | |
siRNA concentration | 2 nmol/l | |
Cell or Organism used | HEK293 cells | |
Transfection method | RNAiMAX | |
Duration after transfection | 24 Hoursrs | |
Article title | 5' Unlocked Nucleic Acid Modification Improves siRNA Targeting |
|
Reference | 23820891 |