| Field | Sense | Antisense |
| siRNA chemical modification | 0 | unlocked nucleic acid |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 1 |
| Position of modifications | 0 | 1 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
OCCOC(CO)CO |
| siRNA Sequence | UGAAUCAGAAGAUGAAGUCAA | GACUUCAUCUUCUGAUUCAAG |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | 5AS_UsiH5 | 5AS_UsiH5 |
| Biological activity | 92 percent target mRNA inhibition | |
| Experiment used to check activity | Dual luciferase assay | |
| Melting temperature (oC) | NA | |
| Target gene | Sensor for S strand luciferase gene | |
| siRNA concentration | 2 nmol/l | |
| Cell or Organism used | HEK293 cells | |
| Transfection method | RNAiMAX | |
| Duration after transfection | 24 Hoursrs | |
| Article title | 5' Unlocked Nucleic Acid Modification Improves siRNA Targeting |
|
| Reference | 23820891 | |