Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 3\'UTR are 15
Results from 0 - 25
siRNA sequence "uuggcuuaacccuacugua" alignment with "Human Coxsackievirus [CV]" virus reference Genome sequences
siRNA sequence matching with "uuggcuuaacccuacugua" Human Coxsackievirus [CV]" Virus reference Genome sequences
Browse all the records for "Human Coxsackievirus [CV]" virus
Browse "virsi2163 " record
Length: 19
GC Content:42 %
Strain of Virus: B3
GenBank Acc: U57056
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Strain of Virus: B3
GenBank Acc: U57056
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Offtargets for "uuggcuuaacccuacugua" siRNA in Human Genome sequences
See U57056 at Genbank
Pubmed:17222937
Article:Expression of short hairpin RNAs against the coxsackievirus B3 exerts potential antiviral effects in Cos-7 cells and in mice.
Authors:Kim JY, Chung SK, Hwang HY, Kim H, Kim JH, Nam JH, Park SI.
Journal:Virus Res. 2007 Apr;125(1):9-13. Epub 2007 Jan 12.
Entrez:17222937
Article:Expression of short hairpin RNAs against the coxsackievirus B3 exerts potential antiviral effects in Cos-7 cells and in mice.
Authors:Kim JY, Chung SK, Hwang HY, Kim H, Kim JH, Nam JH, Park SI.
Journal:Virus Res. 2007 Apr;125(1):9-13. Epub 2007 Jan 12.
Entrez:17222937
siRNA sequence "uuggcuuaacccuacugua" alignment with "Human Coxsackievirus [CV]" virus reference Genome sequences
siRNA sequence matching with "uuggcuuaacccuacugua" Human Coxsackievirus [CV]" Virus reference Genome sequences
Browse all the records for "Human Coxsackievirus [CV]" virus
Browse "virsi2164 " record
Length: 19
GC Content:42 %
Strain of Virus: B3
GenBank Acc: U57056
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Strain of Virus: B3
GenBank Acc: U57056
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Offtargets for "uuggcuuaacccuacugua" siRNA in Human Genome sequences
See U57056 at Genbank
Pubmed:17222937
Article:Expression of short hairpin RNAs against the coxsackievirus B3 exerts potential antiviral effects in Cos-7 cells and in mice.
Authors:Kim JY, Chung SK, Hwang HY, Kim H, Kim JH, Nam JH, Park SI.
Journal:Virus Res. 2007 Apr;125(1):9-13. Epub 2007 Jan 12.
Entrez:17222937
Article:Expression of short hairpin RNAs against the coxsackievirus B3 exerts potential antiviral effects in Cos-7 cells and in mice.
Authors:Kim JY, Chung SK, Hwang HY, Kim H, Kim JH, Nam JH, Park SI.
Journal:Virus Res. 2007 Apr;125(1):9-13. Epub 2007 Jan 12.
Entrez:17222937
siRNA sequence "uuagugguguuaguguaaa" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "uuagugguguuaguguaaa" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi2200 " record
Length: 19
GC Content:32 %
Strain of Virus: Isolate 2741
GenBank Acc: AF206518
Incubation Time (Hours):24
Length: 19
GC Content:32 %
Strain of Virus: Isolate 2741
GenBank Acc: AF206518
Incubation Time (Hours):24
Offtargets for "uuagugguguuaguguaaa" siRNA in Human Genome sequences
See AF206518 at Genbank
Pubmed:19135091
Article:Effective siRNA targeting of the 3' untranslated region of the West Nile virus genome.
Authors:Anthony KG, Bai F, Krishnan MN, Fikrig E, Koski RA.
Journal:Antiviral Res. 2009 Jun;82(3):166-8. Epub 2009 Jan 7.
Entrez:19135091
Article:Effective siRNA targeting of the 3' untranslated region of the West Nile virus genome.
Authors:Anthony KG, Bai F, Krishnan MN, Fikrig E, Koski RA.
Journal:Antiviral Res. 2009 Jun;82(3):166-8. Epub 2009 Jan 7.
Entrez:19135091
siRNA sequence "ccgcgaagugauccaugua" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "ccgcgaagugauccaugua" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi2201 " record
Length: 19
GC Content:53 %
Strain of Virus: Isolate 2741
GenBank Acc: AF206518
Incubation Time (Hours):24
Length: 19
GC Content:53 %
Strain of Virus: Isolate 2741
GenBank Acc: AF206518
Incubation Time (Hours):24
Offtargets for "ccgcgaagugauccaugua" siRNA in Human Genome sequences
See AF206518 at Genbank
Pubmed:19135091
Article:Effective siRNA targeting of the 3' untranslated region of the West Nile virus genome.
Authors:Anthony KG, Bai F, Krishnan MN, Fikrig E, Koski RA.
Journal:Antiviral Res. 2009 Jun;82(3):166-8. Epub 2009 Jan 7.
Entrez:19135091
Article:Effective siRNA targeting of the 3' untranslated region of the West Nile virus genome.
Authors:Anthony KG, Bai F, Krishnan MN, Fikrig E, Koski RA.
Journal:Antiviral Res. 2009 Jun;82(3):166-8. Epub 2009 Jan 7.
Entrez:19135091
siRNA sequence "cguaacuaaacagcacaag" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "cguaacuaaacagcacaag" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1349 " record
Length: 19
GC Content:42 %
Starting position: 29484
Strain of Virus: Urbani
GenBank Acc: AY278741
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 29484
Strain of Virus: Urbani
GenBank Acc: AY278741
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cguaacuaaacagcacaag" siRNA in Human Genome sequences
See AY278741 at Genbank
Pubmed:15652970
Article:Inhibition of SARS-CoV replication by siRNA.
Authors:Wu CJ, Huang HW, Liu CY, Hong CF, Chan YL.
Journal:Antiviral Res. 2005 Jan;65(1):45-8.
Entrez:15652970
Article:Inhibition of SARS-CoV replication by siRNA.
Authors:Wu CJ, Huang HW, Liu CY, Hong CF, Chan YL.
Journal:Antiviral Res. 2005 Jan;65(1):45-8.
Entrez:15652970
siRNA sequence "aaaaacagcauauugacgcug" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "aaaaacagcauauugacgcug" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi1501 " record
Length: 21
GC Content:38 %
GenBank Acc: NC_001474
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):48
Length: 21
GC Content:38 %
GenBank Acc: NC_001474
Transfection Reagent: Calcium Phosohate
Incubation Time (Hours):48
Offtargets for "aaaaacagcauauugacgcug" siRNA in Human Genome sequences
See NC_001474 at Genbank
Pubmed:15301687
Article:Attenuation of dengue virus infection by adeno-associated virus-mediated siRNA delivery.
Authors:Zhang W, Singam R, Hellermann G, Kong X, Juan HS, Lockey RF, Wu SJ, Porter K, Mohapatra SS.
Journal:Genet Vaccines Ther. 2004 Aug 9;2(1):8.
Entrez:15301687
Article:Attenuation of dengue virus infection by adeno-associated virus-mediated siRNA delivery.
Authors:Zhang W, Singam R, Hellermann G, Kong X, Juan HS, Lockey RF, Wu SJ, Porter K, Mohapatra SS.
Journal:Genet Vaccines Ther. 2004 Aug 9;2(1):8.
Entrez:15301687
siRNA sequence "ucuggucguguuaaugacu" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "ucuggucguguuaaugacu" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1782 " record
Length: 19
GC Content:42 %
Starting position: 7361
Strain of Virus: EV71 (5865/Sin/000009)
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 7361
Strain of Virus: EV71 (5865/Sin/000009)
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ucuggucguguuaaugacu" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:16083932
Article:RNA interference against enterovirus 71 infection.
Authors:Sim AC, Luhur A, Tan TM, Chow VT, Poh CL.
Journal:Virology. 2005 Oct 10;341(1):72-9.
Entrez:16083932
Article:RNA interference against enterovirus 71 infection.
Authors:Sim AC, Luhur A, Tan TM, Chow VT, Poh CL.
Journal:Virology. 2005 Oct 10;341(1):72-9.
Entrez:16083932
siRNA sequence "agguccgugagccgcaugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "agguccgugagccgcaugac" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1170 " record
Length: 20
GC Content:65 %
Starting position: 9553
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 20
GC Content:65 %
Starting position: 9553
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "agguccgugagccgcaugac" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ggcuccaucuuagcccuaguc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcuccaucuuagcccuaguc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1167 " record
Length: 21
GC Content:57 %
Starting position: 9517
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 21
GC Content:57 %
Starting position: 9517
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "ggcuccaucuuagcccuaguc" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "ggcuagcugugaaagguccgu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcuagcugugaaagguccgu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1168 " record
Length: 21
GC Content:57 %
Starting position: 9540
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 21
GC Content:57 %
Starting position: 9540
Strain of Virus: Isolate HCR6
GenBank Acc: AY045702
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "ggcuagcugugaaagguccgu" siRNA in Human Genome sequences
See AY045702 at Genbank
Pubmed:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
Article:Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype.
Authors:Watanabe T, Sudoh M, Miyagishi M, Akashi H, Arai M, Inoue K, Taira K, Yoshiba M, Kohara M.
Journal:Gene Ther. 2006 Jun;13(11):883-92.
Entrez:16496015
siRNA sequence "uuucgcaauuccguuuacg" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "uuucgcaauuccguuuacg" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1348 " record
Length: 19
GC Content:42 %
Starting position: 29432
Strain of Virus: Urbani
GenBank Acc: AY278741
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 29432
Strain of Virus: Urbani
GenBank Acc: AY278741
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "uuucgcaauuccguuuacg" siRNA in Human Genome sequences
See AY278741 at Genbank
Pubmed:15652970
Article:Inhibition of SARS-CoV replication by siRNA.
Authors:Wu CJ, Huang HW, Liu CY, Hong CF, Chan YL.
Journal:Antiviral Res. 2005 Jan;65(1):45-8.
Entrez:15652970
Article:Inhibition of SARS-CoV replication by siRNA.
Authors:Wu CJ, Huang HW, Liu CY, Hong CF, Chan YL.
Journal:Antiviral Res. 2005 Jan;65(1):45-8.
Entrez:15652970
siRNA sequence "gguuagaggagaccccucc" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "gguuagaggagaccccucc" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2334 " record
Length: 19
GC Content:63 %
Starting position: 10501
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 19
GC Content:63 %
Starting position: 10501
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "gguuagaggagaccccucc" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
siRNA sequence "ggacuagagguuagaggag" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ggacuagagguuagaggag" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2335 " record
Length: 19
GC Content:53 %
Starting position: 10580
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 19
GC Content:53 %
Starting position: 10580
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "ggacuagagguuagaggag" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
siRNA sequence "aacagcauauugacgcugg" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "aacagcauauugacgcugg" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2336 " record
Length: 19
GC Content:47 %
Starting position: 10616
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 19
GC Content:47 %
Starting position: 10616
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "aacagcauauugacgcugg" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
siRNA sequence "ccagagauccugcugucuc" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ccagagauccugcugucuc" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2337 " record
Length: 19
GC Content:58 %
Starting position: 10641
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 19
GC Content:58 %
Starting position: 10641
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "ccagagauccugcugucuc" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi2163 | uuggcuuaacccuacugua | Human Coxsackievirus [CV] |  SL | refseqs |  | |||||
| virsi2164 | uuggcuuaacccuacugua | Human Coxsackievirus [CV] | SL | refseqs |  | |||||
| virsi2200 | uuagugguguuaguguaaa | West Nile Virus [WNV] |  SL | refseqs |  | |||||
| virsi2201 | ccgcgaagugauccaugua | West Nile Virus [WNV] | SL | refseqs |  | |||||
| virsi1349 | cguaacuaaacagcacaag | SARS Coronavirus | SL | refseqs |  | |||||
| virsi1501 | aaaaacagcauauugacgcug | Dengue Virus [DENV] | SL | refseqs |  | |||||
| virsi1782 | ucuggucguguuaaugacu | Enterovirus [EV] | SL | refseqs |  | |||||
| virsi1170 | agguccgugagccgcaugac | Hepatitis C Virus [HCV] | SL | refseqs |  | |||||
| virsi1167 | ggcuccaucuuagcccuaguc | Hepatitis C Virus [HCV] | SL | refseqs |  | |||||
| virsi1168 | ggcuagcugugaaagguccgu | Hepatitis C Virus [HCV] | SL | refseqs |  | |||||
| virsi1348 | uuucgcaauuccguuuacg | SARS Coronavirus | SL | refseqs |  | |||||
| virsi2334 | gguuagaggagaccccucc | Dengue Virus [DENV] | SL | refseqs |  | |||||
| virsi2335 | ggacuagagguuagaggag | Dengue Virus [DENV] | SL | refseqs |  | |||||
| virsi2336 | aacagcauauugacgcugg | Dengue Virus [DENV] | SL | refseqs |  | |||||
| virsi2337 | ccagagauccugcugucuc | Dengue Virus [DENV] |  SL | refseqs |  |
: siRNA specific for both strands: siRNA specific for only one strands: siRNA Not specific SL: siRNA seedlocator algorithm