VIRsiRNAid | siRNA Sequence | Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
virsi2163 | uuggcuuaacccuacugua | Human Coxsackievirus [CV] | 3'UTR | COS-7 | mRNA | Low | 17222937 | Blast SL | refseqs |       |
virsi2164 | uuggcuuaacccuacugua | Human Coxsackievirus [CV] | 3'UTR | COS-7 | mRNA | Low | 17222937 | Blast SL | refseqs |       |
virsi2200 | uuagugguguuaguguaaa | West Nile Virus [WNV] | 3'UTR | Vero | mRNA | 95 | 19135091 | Blast SL | refseqs |       |
virsi2201 | ccgcgaagugauccaugua | West Nile Virus [WNV] | 3'UTR | Vero | mRNA | 85 | 19135091 | Blast SL | refseqs |       |
virsi1349 | cguaacuaaacagcacaag | SARS Coronavirus | 3'UTR | Vero E6 | RNA | 56 | 15652970 | Blast SL | refseqs |       |
virsi1501 | aaaaacagcauauugacgcug | Dengue Virus [DENV] | 3'UTR | Dendritic Cells | Cell Count | 53 | 15301687 | Blast SL | refseqs |       |
virsi1782 | ucuggucguguuaaugacu | Enterovirus [EV] | 3'UTR | RD | RNA | 44 | 16083932 | Blast SL | refseqs |       |
virsi1170 | agguccgugagccgcaugac | Hepatitis C Virus [HCV] | 3'UTR | Huh-7 | Protein | 35 | 16496015 | Blast SL | refseqs |       |
virsi1167 | ggcuccaucuuagcccuaguc | Hepatitis C Virus [HCV] | 3'UTR | Huh-7 | Protein | 31 | 16496015 | Blast SL | refseqs |       |
virsi1168 | ggcuagcugugaaagguccgu | Hepatitis C Virus [HCV] | 3'UTR | Huh-7 | Protein | 20 | 16496015 | Blast SL | refseqs |       |
virsi1348 | uuucgcaauuccguuuacg | SARS Coronavirus | 3'UTR | Vero E6 | RNA | 10 | 15652970 | Blast SL | refseqs |       |
virsi2334 | gguuagaggagaccccucc | Dengue Virus [DENV] | 3'UTR | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2335 | ggacuagagguuagaggag | Dengue Virus [DENV] | 3'UTR | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2336 | aacagcauauugacgcugg | Dengue Virus [DENV] | 3'UTR | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2337 | ccagagauccugcugucuc | Dengue Virus [DENV] | 3'UTR | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez: