Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 15387899 are 3
Results from 0 - 25
siRNA sequence "caguccccaaccuccaaucacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caguccccaaccuccaaucacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1663 " record
Length: 22
GC Content:55 %
Starting position: 316
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 22
GC Content:55 %
Starting position: 316
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "caguccccaaccuccaaucacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899
siRNA sequence "caggauccucaaccacccac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caggauccucaaccacccac" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1665 " record
Length: 20
GC Content:60 %
Starting position: 488
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Length: 20
GC Content:60 %
Starting position: 488
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48
Offtargets for "caggauccucaaccacccac" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899
siRNA sequence "auguaucccuccuguugcu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "auguaucccuccuguugcu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1664 " record
Length: 19
GC Content:47 %
Starting position: 554
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:47 %
Starting position: 554
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "auguaucccuccuguugcu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1663 | caguccccaaccuccaaucacu | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() | |||||
virsi1665 | caggauccucaaccacccac | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() | |||||
virsi1664 | auguaucccuccuguugcu | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm