VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 15387899 are 3
Results from 0 - 25

siRNA sequence "caguccccaaccuccaaucacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caguccccaaccuccaaucacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1663 " record
Length: 22
GC Content:55 %
Starting position: 316
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caguccccaaccuccaaucacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899

siRNA sequence "caggauccucaaccacccac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caggauccucaaccacccac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1665 " record
Length: 20
GC Content:60 %
Starting position: 488
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine
Incubation Time (Hours):48

Offtargets for "caggauccucaaccacccac" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899

siRNA sequence "auguaucccuccuguugcu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "auguaucccuccuguugcu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1664 " record
Length: 19
GC Content:47 %
Starting position: 554
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "auguaucccuccuguugcu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:15387899
Article:[Establish a screening system for selection of mRNA target sites for HBsAg to construct siRNA with shRNA].
Authors:Yang ZG, Chen Z, Xu N, Ni Q, Pan XC, Jin HY, Li MW.
Journal:Zhonghua Gan Zang Bing Za Zhi. 2004 Sep;12(9):515-8. Chinese.
Entrez:15387899


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1663	caguccccaaccuccaaucacu	Hepatitis B Virus [HBV]	S	HeLa	Protein	63	15387899	Blast SL	refseqs
virsi1665	caggauccucaaccacccac	Hepatitis B Virus [HBV]	S	HeLa	Protein	41	15387899	Blast SL	refseqs
virsi1664	auguaucccuccuguugcu	Hepatitis B Virus [HBV]	S	HeLa	Protein	19	15387899	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm