Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 16638566 are 6
Results from 0 - 25
siRNA sequence "gcacuugucuaccuugaug" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "gcacuugucuaccuugaug" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1331 " record
Length: 19
GC Content:47 %
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 19
GC Content:47 %
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "gcacuugucuaccuugaug" siRNA in Human Genome sequences
See AY304495 at Genbank
Pubmed:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
siRNA sequence "cacugauuccguucgagauc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "cacugauuccguucgagauc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1339 " record
Length: 20
GC Content:50 %
Starting position: 23150
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 20
GC Content:50 %
Starting position: 23150
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "cacugauuccguucgagauc" siRNA in Human Genome sequences
See AY304495 at Genbank
Pubmed:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
siRNA sequence "guggcuuagcuacuucguug" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "guggcuuagcuacuucguug" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1335 " record
Length: 20
GC Content:50 %
Starting position: 26652
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 20
GC Content:50 %
Starting position: 26652
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "guggcuuagcuacuucguug" siRNA in Human Genome sequences
See AY304495 at Genbank
Pubmed:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
siRNA sequence "ugcuugcugcugucuacag" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "ugcuugcugcugucuacag" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1334 " record
Length: 19
GC Content:53 %
Starting position: 26576
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 19
GC Content:53 %
Starting position: 26576
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "ugcuugcugcugucuacag" siRNA in Human Genome sequences
See AY304495 at Genbank
Pubmed:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
siRNA sequence "cguuucggaagaaacagguac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "cguuucggaagaaacagguac" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1336 " record
Length: 21
GC Content:48 %
Starting position: 26113
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 21
GC Content:48 %
Starting position: 26113
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "cguuucggaagaaacagguac" siRNA in Human Genome sequences
See AY304495 at Genbank
Pubmed:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
siRNA sequence "caagccucuucucgcuccuc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "caagccucuucucgcuccuc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1337 " record
Length: 20
GC Content:60 %
Starting position: 28648
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 20
GC Content:60 %
Starting position: 28648
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "caagccucuucucgcuccuc" siRNA in Human Genome sequences
See AY304495 at Genbank
Pubmed:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1331 | gcacuugucuaccuugaug | SARS Coronavirus |  SL | refseqs |  | |||||
| virsi1339 | cacugauuccguucgagauc | SARS Coronavirus | SL | refseqs |  | |||||
| virsi1335 | guggcuuagcuacuucguug | SARS Coronavirus | SL | refseqs |  | |||||
| virsi1334 | ugcuugcugcugucuacag | SARS Coronavirus |  SL | refseqs |  | |||||
| virsi1336 | cguuucggaagaaacagguac | SARS Coronavirus | SL | refseqs |  | |||||
| virsi1337 | caagccucuucucgcuccuc | SARS Coronavirus | SL | refseqs |  |
: siRNA specific for both strands: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm