VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 19490979 are 3
Results from 0 - 25

siRNA sequence "gcgcaauuaacuauuggcaacucca" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gcgcaauuaacuauuggcaacucca" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1776 " record
Length: 25
GC Content:44 %
Starting position: 990
Strain of Virus: EV71 Strain Shzh-98
GenBank Acc: AF302996
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcgcaauuaacuauuggcaacucca" siRNA in Human Genome sequences
See AF302996 at Genbank
Pubmed:19490979
Article:Identification of small interfering RNAs which inhibit the replication of several Enterovirus 71 strains in China.
Authors:Wu Z, Yang F, Zhao R, Zhao L, Guo D, Jin Q.
Journal:J Virol Methods. 2009 Aug;159(2):233-8. Epub 2009 Apr 10.
Entrez:19490979

siRNA sequence "uccagcacuccaagcugcugaaauu" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "uccagcacuccaagcugcugaaauu" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1777 " record
Length: 25
GC Content:48 %
Starting position: 2570
Strain of Virus: EV71 Strain Shzh-98
GenBank Acc: AF302996
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "uccagcacuccaagcugcugaaauu" siRNA in Human Genome sequences
See AF302996 at Genbank
Pubmed:19490979
Article:Identification of small interfering RNAs which inhibit the replication of several Enterovirus 71 strains in China.
Authors:Wu Z, Yang F, Zhao R, Zhao L, Guo D, Jin Q.
Journal:J Virol Methods. 2009 Aug;159(2):233-8. Epub 2009 Apr 10.
Entrez:19490979

siRNA sequence "caugucaccugcgagugcuuaucaa" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "caugucaccugcgagugcuuaucaa" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1778 " record
Length: 25
GC Content:48 %
Starting position: 3020
Strain of Virus: EV71 Strain Shzh-98
GenBank Acc: AF302996
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "caugucaccugcgagugcuuaucaa" siRNA in Human Genome sequences
See AF302996 at Genbank
Pubmed:19490979
Article:Identification of small interfering RNAs which inhibit the replication of several Enterovirus 71 strains in China.
Authors:Wu Z, Yang F, Zhao R, Zhao L, Guo D, Jin Q.
Journal:J Virol Methods. 2009 Aug;159(2):233-8. Epub 2009 Apr 10.
Entrez:19490979


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1776	gcgcaauuaacuauuggcaacucca	Enterovirus [EV]	VP2	RD	mRNA	91	19490979	Blast SL	refseqs
virsi1777	uccagcacuccaagcugcugaaauu	Enterovirus [EV]	VP1	RD	RNA	90	19490979	Blast SL	refseqs
virsi1778	caugucaccugcgagugcuuaucaa	Enterovirus [EV]	VP1	RD	RNA	79	19490979	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm