VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 21535893 are 6
Results from 0 - 25

siRNA sequence "ggcugaucaacaccaacggca" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcugaucaacaccaacggca" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2276 " record
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48

Offtargets for "ggcugaucaacaccaacggca" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893

siRNA sequence "ggcgcagcuucgacgucauau" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcgcagcuucgacgucauau" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2277 " record
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48

Offtargets for "ggcgcagcuucgacgucauau" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893

siRNA sequence "gguugguucgguuguaccugg" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gguugguucgguuguaccugg" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2275 " record
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48

Offtargets for "gguugguucgguuguaccugg" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893

siRNA sequence "ggggucaucgauacccuuacg" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggggucaucgauacccuuacg" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2279 " record
Length: 21
GC Content:57 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48

Offtargets for "ggggucaucgauacccuuacg" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893

siRNA sequence "ggaccaaacguaacaccaacc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggaccaaacguaacaccaacc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2280 " record
Length: 21
GC Content:52 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48

Offtargets for "ggaccaaacguaacaccaacc" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893

siRNA sequence "ggcucgaguauuguguacgag" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggcucgaguauuguguacgag" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2278 " record
Length: 21
GC Content:52 %
Strain of Virus: 1a
GenBank Acc: M62321
Incubation Time (Hours):48

Offtargets for "ggcucgaguauuguguacgag" siRNA in Human Genome sequences
See M62321 at Genbank
Pubmed:21535893
Article:Inhibition of full length hepatitis C virus particles of 1a genotype through small interference RNA.
Authors:Ansar M, Ashfaq UA, Shahid I, Sarwar MT, Javed T, Rehman S, Hassan S, Riazuddin S.
Journal:Virol J. 2011 May 2;8:203.
Entrez:21535893


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi2276	ggcugaucaacaccaacggca	Hepatitis C Virus [HCV]	E	Huh-7	mRNA	93	21535893	Blast SL	refseqs
virsi2277	ggcgcagcuucgacgucauau	Hepatitis C Virus [HCV]	E	Huh-7	mRNA	87	21535893	Blast SL	refseqs
virsi2275	gguugguucgguuguaccugg	Hepatitis C Virus [HCV]	E	Huh-7	mRNA	80	21535893	Blast SL	refseqs
virsi2279	ggggucaucgauacccuuacg	Hepatitis C Virus [HCV]	C	Huh-7	mRNA	70	21535893	Blast SL	refseqs
virsi2280	ggaccaaacguaacaccaacc	Hepatitis C Virus [HCV]	C	Huh-7	mRNA	70	21535893	Blast SL	refseqs
virsi2278	ggcucgaguauuguguacgag	Hepatitis C Virus [HCV]	E	Huh-7	mRNA	66	21535893	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm