VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for C/P are 11
Results from 0 - 25

siRNA sequence "cucaguuuacuagugccauuuguuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cucaguuuacuagugccauuuguuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1155 " record
Length: 25
GC Content:40 %
Starting position: 516

Offtargets for "cucaguuuacuagugccauuuguuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:17049658
Article:Stable inhibition of hepatitis B virus expression and replication in HepG2.2.15 cells by RNA interference based on retrovirus delivery.
Authors:Jia F, Zhang YZ, Liu CM.
Journal:J Biotechnol. 2007 Jan 30;128(1):32-40. Epub 2006 Sep 23.
Entrez:17049658

siRNA sequence "caucacaucaggauuccua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "caucacaucaggauuccua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1154 " record
Length: 19
GC Content:42 %
Starting position: 9

Offtargets for "caucacaucaggauuccua" siRNA in Human Genome sequences
See at Genbank
Pubmed:17049658
Article:Stable inhibition of hepatitis B virus expression and replication in HepG2.2.15 cells by RNA interference based on retrovirus delivery.
Authors:Jia F, Zhang YZ, Liu CM.
Journal:J Biotechnol. 2007 Jan 30;128(1):32-40. Epub 2006 Sep 23.
Entrez:17049658

siRNA sequence "ccuagaagaagaacucccucgccuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ccuagaagaagaacucccucgccuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1470 " record
Length: 25
GC Content:56 %
Incubation Time (Hours):192

Offtargets for "ccuagaagaagaacucccucgccuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "augccccuaucuuaucaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "augccccuaucuuaucaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1467 " record
Length: 19
GC Content:42 %
Starting position: 2309
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72

Offtargets for "augccccuaucuuaucaac" siRNA in Human Genome sequences
See at Genbank
Pubmed:14592428
Article:Inhibition of hepatitis B virus replication by stably expressed shRNA.
Authors:Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, He ML.
Journal:Biochem Biophys Res Commun. 2003 Nov 14;311(2):398-404.
Entrez:14592428

siRNA sequence "agaagaucucaaucucgggaaucuc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "agaagaucucaaucucgggaaucuc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1474 " record
Length: 25
GC Content:44 %
Incubation Time (Hours):192

Offtargets for "agaagaucucaaucucgggaaucuc" siRNA in Human Genome sequences
See at Genbank
Pubmed:12740585
Article:Inhibition of hepatitis B virus in mice by RNA interference.
Authors:McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H, Wieland SF, Marion PL, Kay MA.
Journal:Nat Biotechnol. 2003 Jun;21(6):639-44. Epub 2003 May 12.
Entrez:12740585

siRNA sequence "uaucaacacuuccggaaacua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uaucaacacuuccggaaacua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1130 " record
Length: 21
GC Content:38 %
Starting position: 2321
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "uaucaacacuuccggaaacua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "aagaucucaaucucgggaauc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagaucucaaucucgggaauc" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1134 " record
Length: 21
GC Content:43 %
Starting position: 2422
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aagaucucaaucucgggaauc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "gcgucgcagaagaucucaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gcgucgcagaagaucucaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1133 " record
Length: 19
GC Content:53 %
Starting position: 2414
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcgucgcagaagaucucaa" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "aaacuacuguuguuagacga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaacuacuguuguuagacga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1132 " record
Length: 20
GC Content:35 %
Starting position: 2336
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "aaacuacuguuguuagacga" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "acacuuccgaaacuacuguu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "acacuuccgaaacuacuguu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1131 " record
Length: 20
GC Content:40 %
Starting position: 2326
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "acacuuccgaaacuacuguu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173

siRNA sequence "gaucucaaucucgggaaccucaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaucucaaucucgggaaccucaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1135 " record
Length: 23
GC Content:48 %
Starting position: 2358
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gaucucaaucucgggaaccucaa" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:19026173
Article:Optimal design and validation of antiviral siRNA for targeting hepatitis B virus.
Authors:Fu J, Tang ZM, Gao X, Zhao F, Zhong H, Wen MR, Sun X, Song HF, Qian XH.
Journal:Acta Pharmacol Sin. 2008 Dec;29(12):1522-8.
Entrez:19026173


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1155	cucaguuuacuagugccauuuguuc	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	93	17049658	Blast SL	refseqs
virsi1154	caucacaucaggauuccua	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	92	17049658	Blast SL	refseqs
virsi1470	ccuagaagaagaacucccucgccuc	Hepatitis B Virus [HBV]	C/P	Huh-7	Protein	92	12740585	Blast SL	refseqs
virsi1467	augccccuaucuuaucaac	Hepatitis B Virus [HBV]	C/P	HepG2	RNA	88	14592428	Blast SL	refseqs
virsi1474	agaagaucucaaucucgggaaucuc	Hepatitis B Virus [HBV]	C/P	Huh-7	Protein	77	12740585	Blast SL	refseqs
virsi1130	uaucaacacuuccggaaacua	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	48	19026173	Blast SL	refseqs
virsi1134	aagaucucaaucucgggaauc	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	33	19026173	Blast SL	refseqs
virsi1133	gcgucgcagaagaucucaa	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	30	19026173	Blast SL	refseqs
virsi1132	aaacuacuguuguuagacga	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	27	19026173	Blast SL	refseqs
virsi1131	acacuuccgaaacuacuguu	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	10	19026173	Blast SL	refseqs
virsi1135	gaucucaaucucgggaaccucaa	Hepatitis B Virus [HBV]	C/P	HepG2.2.15	Protein	4	19026173	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm